1. Where is the PAN Facility located/contact info?
2. What is the turnaround time?
3. What is the deadline for sample submission?
   
4. How much does it cost?
5. What primers does the PAN Facility provide?
6. What concentration should the DNA be?
7. Why do the results look bad?
8. Why can’t I download my results?
9. Why am I unable to log-in?
   
   

1. Where is the PAN Facility located/contact info? (top)
We are located in the basement of the Beckman Center, B017.  We also have a drop-off area in the cold room B008.

Phone: (650) 723-3189
Email: dnaseq@stanford.edu

Shipping Address:        
PAN Facility - DNA Sequencing
Beckman Center, B017
279 Campus Drive, West
Stanford, Ca 94305

2. What is the turnaround time? (top)
When samples are dropped off by the deadline (see below), results will be sent to the email address associated with the order by noon the following business day. Please contact us if you are running behind as we can usually wait for you. Also, if you cannot find or have questions about your data, please contact us at dnaseq@stanford.edu or 650-723-3189.

3. What is the deadline for sample submission? (top)
Drop-off deadline is 12:00 PM

Please contact us if you're running late as we can usually wait.

4. How much does it cost? (top)
Please check our current price list.

5. What primers does the PAN Facility provide? (top)

M13Fwd	5’- TGTAAAACGACGGCCAGT -3’
M13Rev	5’- CAGGAAACAGCTATGACC -3’
T7	5’- TAATACGACTCACTATAGGG -3’
T3	5’- ATTAACCCTCACTAAACCCA -3’
Sp6	5’- ATTTAGGTGACACTATAG -3’

6 . What concentration should the DNA be? (top)

Template	Size	Concentration	Volume
PCR products	100bp-2000-bp	1-10ng/ul	10ul
	>2000bp	10-20ng/ul	10ul
Plasmids (dsDNA)	2kb-8kb	50-100ng/ul	10ul
Large Plasmids	>10kb	100-200ng/ul	10ul
Custom Primer		5uM (5pmol/ul)	2ul


*For custom primer, please premix template and primer prior to submission.

7. Why do the results look bad? (top)
There are a few reasons for “bad” data.  Please go to our webpage "Data Analysis" to find the cause and solution for bad data.  Remember most reruns and resequences are free.

8. Why can't I download my data? (top)
Please contact us at dnaseq@stanford.edu if there are issues downloading your data.

9. Why am I unable to log-in? (top)
Please contact us at dnaseq@stanford.edu to troubleshoot any login issues. If you’d like to place an order without logging in, please request the DNA Sequencing Submission Form.