» DNA Sequencing
   & Fragment Analysis
 

Place Order
View Orders
Sample Submission
Data Analysis
Software
FAQs
Prices

 
  Genomic Services
• Oligo Synthesis
• Gene Expression
• Real-Time PCR
• Pyrosequencing
• Next Gen Sequencing
• DNA Sequencing
   & Fragment Analysis
• Single Cell Genomics
• RNA/DNA QC
‡ Bioanalyzer QC
‡ Fragment Analyzer QC
  Protein Services
• Peptide Synthesis
• Mass Spectrometry
• Protein Analytics
‡ Mass Mapping
‡ Edman Sequencing
• Biacore
• Antibody
 
 
Located in rooms
B065 and B017
bklogo

 

DNA Sequencing/Fragment Analysis
 

SAMPLE SUBMISSION
DNA SEQUENCING
FRAGMENT ANALYSIS



TYPES OF DNA SEQUENCING SERVICES
(top)

Service
Description
Sample Submission Format
Full Service

 

  • Purified DNA template sample submitted by customer
    • Custom primers should be premixed in tube

  • BigDye DNA sequencing reaction performed by PAN
    • Requested PAN primers will be added
  • DNA sequencing reaction clean-up performed by PAN
  • Sample run on ABI 3130xl by PAN
  • Submission deadline 12:00pm
  • Labeling - please write Record Number(s) on tube(s).


epp rnc *Click here for Template and primer concentration.
Click here for a list of PAN provided primers.
Clean-Up & Run

 

  • BigDye DNA sequencing reaction submitted by customer

  • DNA sequencing reaction clean-up performed by PAN
  • Sample run on ABI 3130xl by PAN
  • Submission deadline 2:00pm
  • Labeling - please write Record Number(s) on tube(s).


Run Only

 

  • BigDye DNA sequencing & clean-up performed by customer

  • Sample run on ABI 3130xl by PAN
  • Submission deadline 3:00pm
  • Labeling - please write Record Number(s) on tube(s).


epp rc

 




TEMPLATE and PRIMER CONCENTRATIONS
(top)

Template
PCR products

100bp-2000-bp

1-10ng/ul

10ul

 

>2000bp

10-20ng/ul

10ul

Plasmids (dsDNA)

2kb-8kb

50-100ng/ul

10ul

Large Plasmids

>10kb

100-200ng/ul

10ul

Custom Primer

5uM (5pmol/ul)

2ul

  • Template should be provided as purified plasmid or PCR product.
    • We recommend using kits from Qiagen. .
  • Premix template and custom primer prior to submission.
    • One template + one primer sample tube.
    • Template and primer should be provided in water.
  • Primer should be 18-24 bases long, with Tm of 45-60°C
  • Please be aware the first ~25 bases of a sequence maybe unreadable.
  • 10ul-12ul total volume is requested to allow for resequencing if necessary
  • All samples submitted to PAN are discarded after 2 weeks.

Sorry, we are no longer accepting BAC, cosmid, or bacterial genomic DNA samples.

 




DNA SEQUENCING PROTOCOL
(top)

Reagents

Big Dye (1/4rxn)

dGTP

Big Dye v3.1

2ul

2ul

Template:
Plasmid (200-500ng)
PCR (10-100ng)

5ul

4ul

Primer (5uM)

1ul

1ul

dGTP

1ul

DMSO (50%)

1ul

5X Buffer

 

Water

2ul

Total

10ul

10ul

 




THERMAL CYCLING CONDITIONS
(top)

On ABI
Thermocycler

Plasmid/PCR/dGTP

Initial Denaturing

96°C - 2min**

Denaturing
Annealing
Extension

96°C - 10sec
50°C - 5sec
60°C - 4min

} x25 cycles

HOLD

4°C - œ

  • **For sample with possible secondary structure (before adding BigDye) denature sample at 96°C - 2min, chill immediately in ice bath. Once cooled add Bigdye and place back on thermal cycler for remaining cycling steps.
  • We recommend sephadex bead clean-up.

 




PAN PRIMER LIST
(top)

M13 Forward

5’- TGTAAAACGACGGCCAGT -3’

M13 Reverse

5’- CAGGAAACAGCTATGACC -3’

T7

5’- TAATACGACTCACTATAGGG -3’

Sp6

5’- ATTTAGGTGACACTATAG -3’

T3

5’- ATTAACCCTCACTAAAGGGA -3’





TYPES OF FRAGMENT ANALYSIS SERVICES (top)

Service
Description
Sample Submission Format
Clean-up & Run
  • PCR performed by customer
  • Reaction cleaned-up by PAN
  • Size standards added by PAN
  • Sample run on instrument by PAN
  • Additionl dilutions upon request
  • 1ul-10ul of PCR product
  • Record number on top of tube or plate
Run Only
  • PCR performed by customer
  • Size standards added by PAN
  • Sample run on instrument by PAN
  • Additionl dilutions upon request
  • 1ul-10ul of PCR product
  • Record number on top of tube or plate
  • 1ul of PCR product will be loaded with 0.25ul size standard and 10ul formamide, if additional dilutions are needed please let us know. RFU should be around ~1000-4000.
  • Clean-up of PCR reaction is not necessary, if requested sephadex G50 beads are used for clean-up.
  • All samples submitted to PAN are saved for 2 weeks.

 



PAN SIZE STANDARD LIST
(top)

SIZE STANDARD DYE
FRAGMENT DETECTION DYES
FILTER SET
DYE SET

GeneScan 500-ROX

6-FAM, HEX, NED

D
DS-30

GeneScan 500-LIZ

6-FAM, VIC, NED, PET

G5
DS-33

CUSTOM DYES or KITS

PLEASE CONTACT PAN

INQUIRE
INQUIRE

GeneScan-500 is designed for sizing DNA fragments in the 35-500bp range and provides 16-single stranded labeled fragments of 35*, 50, 75, 100, 139, 150, 160, 200, 250, 250*, 300, 340*, 350, 400, 450, 490, and 500 bases.

(*) On capillary electrophorsis instruments, the 250bp and 340bp peaks are subject to temperature variations. Fragment analysis primer peaks can interfere with the detection of the 35bp peak. These peaks may need to omitted, optimize your analysis based on this information.